sucrose is the primary transport sugar and plays a central role in plant growth and development
Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt
... acetylsalicylic acid (ASA) was added to the anticoagulant [17] The final concentration of ASA in the blood was mM Platelet aggregation and ATP-secretion in blood Whole blood platelet aggregation was ... study, assisted in designing the experiments, discussed and interpreted the results throughout the study, and wrote together with SD and DP the paper All the authors have read and approved the final ... than aspirin in inhibiting the effect of ADP on platelets in blood and (2) NSC23766 inhibits a- granule secretion and platelet aggregation stimulated by ADP independent of platelet prostaglandin-endoperoxide...
- 10
- 441
- 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt
... Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL ... This targeting pattern was statistically indistinguishable from that of another Toc75 mutant in which most of the glycine residues were replaced with alanine (Table 1, polyAla; Fig 2A, lanes 7–12; ... 24 tion apparatus, faces the stromal compartment J Biol Chem 273, 16583–16588 Gunasekaran K, Nagarajaram HA, Ramakrishnan C & Balaram P (1998) Stereochemical punctuation marks in protein structures:...
- 9
- 496
- 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot
... constant was converted to half-time of labelling according to the following relationship: t1=2 ¼ Ln2=k Statistical analysis All data manipulations and statistical analyses were performed using graphpad ... Catalytic intermediate CM BM FM Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP ... determine how changes in the extent and rate of labelling reflect conformational changes in TM12, we used molecular models of ABCB1 [30] in the basal and ATP-bound states as the basis for in silico...
- 12
- 380
- 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx
... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions The total RNA was converted to single-stranded cDNA using a random primer and ReverTra Ace (Toyobo, Osaka, Japan) The ... compilation ª 2008 FEBS T Hishida et al fad49 plays a crucial role in adipogenesis Fig Amino acid sequence and domain structure of FAD49 (A) Amino acid sequence of mouse FAD49 The PX domain is underlined...
- 13
- 385
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... carried out in duplicate isolated and incubated in the same way as the experiments with MonoMac cells (Fig 3) In addition to TNF -a, the in ammatory cytokine IL-6 was also measured to check that ... the plate and incubated for h The plate was washed as above and 100 lL 200 ngÆmL)1 biotinylated detection antibody (R&D, Abingdon, UK) in dilution buffer added After incubating for h, the plate ... plate was washed, 100 lL streptavidin–horseradish peroxidase conjugate (0.6 lgÆmL)1, Zymed, San Francisco, CA, USA) added and the plate incubated for 20 The plate was washed and 100 lL of tetramethylbenzidine...
- 7
- 322
- 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, no matter ... a1 b1 and a2 b2 interfaces, on the other hand, negligible changes are found insofar as the crystal structure was examined Consequently, these are called simply the packing contacts, and their role ... rate constant kf is attributed to the a chains and a slow rate constant ks is for the b chains in the HbO2 tetramer P is the molar fraction of the rapidly reacting hemes This conclusion is based...
- 10
- 648
- 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
... of coordination and crosstalk must exist between pathways involved in Pi and sulfate transport and homeostasis in plants, important players acting in this coordination remain to be clearly identified ... 2008, 147:897-911 Maruyama-Nakashita A, Nakamura Y, Tohge T, Saito K, Takahashi H: Arabidopsis SLIM1 is a central transcriptional regulator of plant sulfur response and metabolism Plant Cell 2006, ... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from...
- 10
- 427
- 0
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx
... GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAAGAATAGTTT TTGCTGTAC/GTACAGCAAAAACTATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT CC,696+ 2A, ... TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAATAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCTTAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, ... GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGGTAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT GCTG/CAGCAAAAACTATTCTGGCAGCTAAGGCAG CACCTACCAAGCCTC The NheI-BamHI...
- 12
- 337
- 0
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx
... demonstrate an increased translation of these transcripts and validate the array data indicating no change or a slight decrease in LTBP1, SYNE-1 and MMP3 transcript levels in the total RNA compartment and ... and polysomal of the array data by on sucrose gradient Validation Validation of the array data by real time PCR (a) using total and polysome-bound RNA populations and (b) using individual fractions ... We also thank Deepak Kolippakkam and Neha Lohia for assistance in data analysis and Paul Farley for assistance in the preparation of the manuscript 20 References 21 10 11 12 13 14 15 Williams...
- 14
- 384
- 0
Báo cáo sinh học: " Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells" pdf
... Dendroaspis natriuretic peptide, DNP, and urodilatin [3] The activities of ANP and BNP are similar, and their biological actions, such as vasodilation and natriuresis, are mediated through binding to their ... characteristic of allergic disease [7] However, the mechanism by which NPRA signaling in DCs alters the innate and adaptive immune responses is unclear In animal models of allergic lung inflammation, ... asthma and anti-inflammatory activity in human epithelial cells [9] The amino acid sequence of this peptide is different from ANP and NP73-102 does not bind to NPRA and prevent ANP from attaching...
- 12
- 268
- 0
Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx
... which is a potent herbicide and carcinogen and therefore unsuitable for pharmaceutical and food industries [10] From this point of view, our system is apparently favourable for the process scale ... initial nitrogen concentration of 40 mM and the cell growth was inhibited at a high initial nitrogen concentration of 80 mM Similarly, the accumulation of total saponin and polysaccharide were also ... temperature may also effective in increasing productivity In this paper, we established cell suspension culture of ginseng cell and some attempts have been made to increase biomass and ginsenoside...
- 6
- 492
- 0
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx
... 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢ for Ugt2b37; 5¢-GGGAAGGACATGAAGGAGAGAGC-3¢ and ... 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-3¢ for Akr1b8; ... primers were as follows: 5¢-CCCCTTACAGCTCTG CTTCATT-3¢ and 5¢-TCAAGAATGGATACACATAAA CACAAGGA-3¢ for Cyp2c29; 5¢-CCAGCTCTGCTTCAT TCCTCTCT-3¢ and 5¢-CGCAGGAATGGATAAACATA AGCA-3¢ for Cyp2c38; 5¢-ACTTCTCTGTGGCAAGCCC...
- 9
- 280
- 0
báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc
... signaling is associated with the pathways that lead to NFB activation and pro-inflammatory responses In contrast, TLR signaling pathways that activate IRFs can induce antiinflammatory mediators ... proand anti-inflammatory cytokines and chemokines in the plasma we examined the levels of seven molecules using ELISAs The results indicate that the level of pro-inflammatory cytokines, such as ... influencing pro-inflammatory cytokine production [3,31] In particular, administration of the NFB inhibitor Tat-NEMO Binding Domain provided protection against hypoxia-ischemia in neonatal rats...
- 12
- 215
- 0
Báo cáo y học: "c-Fms-mediated differentiation and priming of monocyte lineage cells play a central role in autoimmune arthritis" docx
... types and responses in autoimmune arthritis and represents a promising approach to the treatment of RA Clinical trials are warranted to evaluate the efficacy and therapeutic index of c-Fms inhibitors ... aberrantly activated: an increase in macrophage infiltration Page of 15 of the synovium promotes inflammation via the production of TNF and other proinflammatory cytokines, and an increase in osteoclast ... NIH National Institute of Arthritis and Musculoskeletal and Skin Diseases R01 AR-054822, and Veterans Affairs Health Care System funding awarded to WHR as well as an NIH F31 Fellowship Award and...
- 15
- 411
- 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... Onion arabinogalactan consists of 99% D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan ... arabinogalactan consists of 57% D-galactose and 38% L-arabinose Methylation analysis demonstrated that a substantial amount of the L-arabinose residues (14%) in soy arabinogalactan is present as terminal residues ... amount of a- L-1,3-arabinofuranosidase was responsible for the disappearance of Fig HPAEC analysis of the hydrolysis of arabinogalactans by GALA Three different arabinogalactans were used: potato (r),...
- 9
- 669
- 0
Is the link between output and jobs broken
... rates and of the three main financial balances in this baseline case—that is, the negative of the private sector balance, the government deficit, and the current account balance—are illustrated in ... of the American Taxpayer Relief Act of 2013, the law that averted or delayed most tax increases and spending cuts contained in the so-called “fiscal cliff.” This lastminute agreement allowed taxes ... slightly smaller than the increase that we assumed for the baseline simulation, plus a small increase in the direct taxation in 2013 An increase of real government purchases of final goods and government...
- 16
- 226
- 0
Tài liệu NTP-CERHR Monograph on the Potential Human Reproductive and Developmental Effects of Di-Isodecyl Phthalate (DIDP) pdf
... conclusions are based on the information available at the time this brief was prepared As new information on toxicity and exposure accumulate, it may form the basis for either lowering or raising the ... upon the results of the initial study The Panel further recognized that data gathering should be an iterative process and that the recommendations may change as initial tiers of data are gathered ... palmitoyl-CoA oxidation in both sexes There was a significant increase in the 11- and 12-hydroxylation (11- and 12-OH) of lauric acid (all treated males), and in the 12-OH level in females at...
- 147
- 858
- 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
... FERM and PDZ-domain-containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is ... determinants of the protein–protein interaction between v-KIND and MAP2 (i.e the MAP2-binding core module in v-KIND and the v-KIND-binding core module in MAP2) across a range of amino acid residues, and ... module MAP2 consists of three main structural domains: the cAMP-dependent protein kinase regulatory subunit RII binding domain, the central domain (CD) and the microtubule-binding domain (Fig 3A) ...
- 11
- 658
- 0
Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf
... uptake of satu- rated and unsaturated FFAs into the cells After their internalization, FFAs are converted to fatty acyl-CoA, a reaction catalyzed by ACS Fatty acyl-CoAs are activated forms of fatty ... peroxidase-conjugated antibody against caspase-3 (#610325) was from BD Pharmigen, and antibody against b-actin (A5 441) was from Sigma Statistical analysis Determination of TAG levels Cells seeded in ... et al Ctrl A SA OA SA/OA B 6h 3h SA/OA OA Counts Ctrl SA/OA Ctrl SA SA 24 h 12 h 36 h SA/OA OA OA SA/OA Ctrl OA Ctrl SA/OA Ctrl OA SA SA SA FL1-Log Fig Stearate (SA) supplementation interrupts...
- 12
- 721
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25